Transcript: Mouse XM_006532543.2

PREDICTED: Mus musculus zinc finger protein 286 (Zfp286), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp286 (192651)
Length:
2896
CDS:
386..1597

Additional Resources:

NCBI RefSeq record:
XM_006532543.2
NBCI Gene record:
Zfp286 (192651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084152 CGTTGGCTAGAACATCGTCAA pLKO.1 509 CDS 100% 4.050 5.670 N Zfp286 n/a
2 TRCN0000084150 CGTTCATTCGTCAGCTCTTAT pLKO.1 1456 CDS 100% 13.200 10.560 N Zfp286 n/a
3 TRCN0000084148 CCTCTCGTTCAGTAAGGAAAT pLKO.1 1926 3UTR 100% 10.800 7.560 N Zfp286 n/a
4 TRCN0000084151 GTTGGCTAGAACATCGTCAAA pLKO.1 510 CDS 100% 4.950 3.465 N Zfp286 n/a
5 TRCN0000084149 CCCGATAACTATAATTCGGAA pLKO.1 311 5UTR 100% 2.640 1.848 N Zfp286 n/a
6 TRCN0000234230 ACTGGAGAGAAGCCCTATAAA pLKO_005 1160 CDS 100% 15.000 7.500 Y EG666702 n/a
7 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 827 CDS 100% 15.000 7.500 Y Gm10771 n/a
8 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 827 CDS 100% 15.000 7.500 Y ZNF286B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532543.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.