Transcript: Mouse XM_006532663.3

PREDICTED: Mus musculus schlafen 4 (Slfn4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slfn4 (20558)
Length:
3886
CDS:
1156..2964

Additional Resources:

NCBI RefSeq record:
XM_006532663.3
NBCI Gene record:
Slfn4 (20558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088043 CGTTGGTATTTCCTTTGTAAA pLKO.1 3436 3UTR 100% 13.200 9.240 N Slfn4 n/a
2 TRCN0000088045 CGAGAAATGTCTTAACTCATA pLKO.1 2933 CDS 100% 4.950 2.970 N Slfn4 n/a
3 TRCN0000077443 GCCGAGTTAAAGGGCTATTAT pLKO.1 2614 CDS 100% 15.000 7.500 Y Slfn3 n/a
4 TRCN0000088044 GCGCCGAGTTAAAGGGCTATT pLKO.1 2612 CDS 100% 10.800 5.400 Y Slfn4 n/a
5 TRCN0000088046 CTTAGGAAGTTATGAGTCTTT pLKO.1 2835 CDS 100% 4.950 2.475 Y Slfn4 n/a
6 TRCN0000088047 TCTTAGGAAGTTATGAGTCTT pLKO.1 2834 CDS 100% 4.950 2.475 Y Slfn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.