Transcript: Mouse XM_006532743.3

PREDICTED: Mus musculus suppressor of Ty 6 (Supt6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Supt6 (20926)
Length:
5627
CDS:
699..5510

Additional Resources:

NCBI RefSeq record:
XM_006532743.3
NBCI Gene record:
Supt6 (20926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093120 CGGATCATGAAGATCGATATT pLKO.1 4125 CDS 100% 13.200 18.480 N Supt6 n/a
2 TRCN0000332144 CGGATCATGAAGATCGATATT pLKO_005 4125 CDS 100% 13.200 18.480 N Supt6 n/a
3 TRCN0000093121 CGTATCCAAGACCCTCTGATA pLKO.1 3084 CDS 100% 4.950 6.930 N Supt6 n/a
4 TRCN0000306343 AGAGCTCAGTTGTAGGTATAA pLKO_005 3713 CDS 100% 13.200 10.560 N Supt6 n/a
5 TRCN0000306284 GTCCATAAAGTGGCGTGAAAT pLKO_005 5600 3UTR 100% 13.200 10.560 N Supt6 n/a
6 TRCN0000306341 CTAGTAGCTTCAGTCGTAAAG pLKO_005 1363 CDS 100% 0.000 0.000 N Supt6 n/a
7 TRCN0000306282 ACCCGTCCTTCCATAACATAA pLKO_005 4324 CDS 100% 13.200 9.240 N Supt6 n/a
8 TRCN0000093119 CCCAACCAAGAAAGGTAGAAA pLKO.1 2186 CDS 100% 5.625 3.938 N Supt6 n/a
9 TRCN0000093122 CTTGTGAATAAGAAGCCTCAT pLKO.1 2847 CDS 100% 4.050 2.835 N Supt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.