Transcript: Mouse XM_006532750.3

PREDICTED: Mus musculus secreted and transmembrane 1A (Sectm1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sectm1a (209588)
Length:
1650
CDS:
150..728

Additional Resources:

NCBI RefSeq record:
XM_006532750.3
NBCI Gene record:
Sectm1a (209588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182132 CGATCGGCATAGGCTTCATTA pLKO.1 1166 3UTR 100% 13.200 18.480 N Sectm1a n/a
2 TRCN0000376854 CGCCGGATTCATTACGTTTAT pLKO_005 683 CDS 100% 13.200 18.480 N Sectm1a n/a
3 TRCN0000216874 GACAAGACCATCTTCGATAAA pLKO.1 366 CDS 100% 13.200 18.480 N Sectm1a n/a
4 TRCN0000379280 CACGCGAAGAGCTCTCCAATA pLKO_005 606 CDS 100% 10.800 15.120 N Sectm1a n/a
5 TRCN0000197661 CGGATTCATTACGTTTATCTA pLKO.1 686 CDS 100% 5.625 7.875 N Sectm1a n/a
6 TRCN0000178396 GATTTGCTTCAGGTACAACTT pLKO.1 1261 3UTR 100% 4.950 6.930 N Sectm1a n/a
7 TRCN0000379342 GAGTACAGCCTCCTGACTATG pLKO_005 1076 3UTR 100% 10.800 8.640 N Sectm1a n/a
8 TRCN0000366840 ACACCATGGAAGTCATCATTA pLKO_005 890 3UTR 100% 13.200 9.240 N Sectm1a n/a
9 TRCN0000182058 CTCCCTGAATGCTCAGAATAA pLKO.1 218 CDS 100% 13.200 9.240 N Sectm1a n/a
10 TRCN0000376855 GACGACCACACAGGGATATAC pLKO_005 471 CDS 100% 13.200 9.240 N Sectm1a n/a
11 TRCN0000366786 TCCCAGACACTACGCTCTTTA pLKO_005 571 CDS 100% 13.200 9.240 N Sectm1a n/a
12 TRCN0000379343 ACATCACCCTGAATATCTTAG pLKO_005 529 CDS 100% 10.800 7.560 N Sectm1a n/a
13 TRCN0000366841 GGACAAGACCATCTTCGATAA pLKO_005 365 CDS 100% 10.800 7.560 N Sectm1a n/a
14 TRCN0000198636 CTGAGGATCATAGAGCATCTT pLKO.1 1474 3UTR 100% 4.950 3.465 N Sectm1a n/a
15 TRCN0000178147 GATGACCTGTAACATCTCTAA pLKO.1 302 CDS 100% 4.950 3.465 N Sectm1a n/a
16 TRCN0000198951 GACTCACAACAGAAACGAGTT pLKO.1 1301 3UTR 100% 4.050 2.835 N Sectm1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532750.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.