Transcript: Mouse XM_006532850.2

PREDICTED: Mus musculus microfibrillar-associated protein 3 (Mfap3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfap3 (216760)
Length:
4798
CDS:
178..1227

Additional Resources:

NCBI RefSeq record:
XM_006532850.2
NBCI Gene record:
Mfap3 (216760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374963 GGTCTTCCCGTTAACCTTAAA pLKO_005 1294 3UTR 100% 13.200 18.480 N Mfap3 n/a
2 TRCN0000091964 CGCCTTCACAATCACACTCAT pLKO.1 627 CDS 100% 4.950 6.930 N Mfap3 n/a
3 TRCN0000091967 CGCTCAAAGTGGCATCTATGT pLKO.1 990 CDS 100% 4.950 6.930 N Mfap3 n/a
4 TRCN0000091966 CCATGGAGTTTGCCCGATATA pLKO.1 830 CDS 100% 13.200 9.240 N Mfap3 n/a
5 TRCN0000366304 GACCTTATTCTGCACTCTAAT pLKO_005 1610 3UTR 100% 13.200 9.240 N Mfap3 n/a
6 TRCN0000366355 ATGATGTCATTATAGTCAAAG pLKO_005 335 CDS 100% 10.800 7.560 N Mfap3 n/a
7 TRCN0000374964 TGATGACCGTGGGCTCTATAC pLKO_005 504 CDS 100% 10.800 7.560 N Mfap3 n/a
8 TRCN0000375021 TTCTCACGGTGGATCAGTATG pLKO_005 383 CDS 100% 10.800 7.560 N Mfap3 n/a
9 TRCN0000091965 GCATCATTTCTCCCAAGCTTT pLKO.1 286 CDS 100% 4.950 3.465 N Mfap3 n/a
10 TRCN0000366356 TTCTCAAGACAGTAGTCATTT pLKO_005 1146 CDS 100% 13.200 7.920 N Mfap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.