Transcript: Mouse XM_006532869.3

PREDICTED: Mus musculus dehydrogenase/reductase (SDR family) member 7B (Dhrs7b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhrs7b (216820)
Length:
1297
CDS:
126..1091

Additional Resources:

NCBI RefSeq record:
XM_006532869.3
NBCI Gene record:
Dhrs7b (216820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198546 GCTACATCCATACCAACCTCT pLKO.1 826 CDS 100% 2.640 2.112 N Dhrs7b n/a
2 TRCN0000181732 GACAGACTTTGTGCCATCCAT pLKO.1 980 CDS 100% 3.000 2.100 N Dhrs7b n/a
3 TRCN0000176787 CATTAGTGATACCATAGTGGA pLKO.1 563 CDS 100% 2.640 1.848 N Dhrs7b n/a
4 TRCN0000198683 CCAGGCATTCTTTGACTGTCT pLKO.1 755 CDS 100% 2.640 1.848 N Dhrs7b n/a
5 TRCN0000197964 GAAATAAACTACTTTGGCCCT pLKO.1 603 CDS 100% 0.540 0.378 N Dhrs7b n/a
6 TRCN0000198372 GATGTTCTCCTGACAGACTTT pLKO.1 969 CDS 100% 4.950 2.970 N Dhrs7b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.