Transcript: Mouse XM_006533010.2

PREDICTED: Mus musculus sterile alpha motif domain containing 14 (Samd14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Samd14 (217125)
Length:
3445
CDS:
832..2091

Additional Resources:

NCBI RefSeq record:
XM_006533010.2
NBCI Gene record:
Samd14 (217125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105795 GCCCAGTAATAAACCCAATTT pLKO.1 2247 3UTR 100% 13.200 18.480 N Samd14 n/a
2 TRCN0000105797 CCGCGAGAACGATGCCAAGAA pLKO.1 2064 CDS 100% 1.650 2.310 N Samd14 n/a
3 TRCN0000105796 AGAAGTCAGCTTCCCAGGAAT pLKO.1 1643 CDS 100% 4.950 3.465 N Samd14 n/a
4 TRCN0000105799 GACCAAGTGTTCCTATCCCTA pLKO.1 1731 CDS 100% 2.640 1.848 N Samd14 n/a
5 TRCN0000105798 CCAGTGGCTACACAGCCTCAA pLKO.1 1833 CDS 100% 1.350 0.945 N Samd14 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 482 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.