Transcript: Mouse XM_006533200.2

PREDICTED: Mus musculus zinc finger protein 62 (Zfp62), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp62 (22720)
Length:
4336
CDS:
635..3358

Additional Resources:

NCBI RefSeq record:
XM_006533200.2
NBCI Gene record:
Zfp62 (22720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084803 CGTGGAAAGCAGCCCTATAAT pLKO.1 3005 CDS 100% 15.000 21.000 N Zfp62 n/a
2 TRCN0000414677 GTCGAACACTTTAGGACTATA pLKO_005 3474 3UTR 100% 13.200 18.480 N Zfp62 n/a
3 TRCN0000427986 TCTCACTCTCAAGCCTTATAA pLKO_005 2295 CDS 100% 15.000 19.500 N Zfp62 n/a
4 TRCN0000431742 ATCTCACGCTCAAGCCTTAAA pLKO_005 2042 CDS 100% 13.200 17.160 N Zfp62 n/a
5 TRCN0000084807 CGTCCTATACATGTGATGAAT pLKO.1 2679 CDS 100% 5.625 4.500 N Zfp62 n/a
6 TRCN0000084804 GCAGCTATTGTGAGAAATCTT pLKO.1 2103 CDS 100% 5.625 3.938 N Zfp62 n/a
7 TRCN0000084806 CACACATACAAACGCAGCAAA pLKO.1 817 CDS 100% 4.950 3.465 N Zfp62 n/a
8 TRCN0000084805 GCCTTAAAGTACATAAGCGAA pLKO.1 2223 CDS 100% 2.640 1.848 N Zfp62 n/a
9 TRCN0000413392 ACGTACACCCTGCTCATATTG pLKO_005 969 CDS 100% 13.200 7.920 N Zfp62 n/a
10 TRCN0000107697 CAGAAACAACTCAAGCCTTAA pLKO.1 2545 CDS 100% 10.800 6.480 N ZFP62 n/a
11 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 1662 CDS 100% 5.625 2.813 Y ZNF829 n/a
12 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 1490 CDS 100% 4.050 2.025 Y ZNF260 n/a
13 TRCN0000147367 GAATGTGATGAATGTGGGAAA pLKO.1 1511 CDS 100% 4.050 2.430 N ZNF658B n/a
14 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1746 CDS 100% 13.200 6.600 Y Znf41-ps n/a
15 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1746 CDS 100% 13.200 6.600 Y EG666605 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.