Transcript: Mouse XM_006533269.2

PREDICTED: Mus musculus hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing (Hexdc), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hexdc (238023)
Length:
2046
CDS:
140..1819

Additional Resources:

NCBI RefSeq record:
XM_006533269.2
NBCI Gene record:
Hexdc (238023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181116 CGTCACACAAATTAGTCTCCA pLKO.1 1462 CDS 100% 2.640 3.696 N Hexdc n/a
2 TRCN0000180062 CCAGTTATGATCCAGCACATA pLKO.1 1574 CDS 100% 4.950 3.465 N Hexdc n/a
3 TRCN0000184088 CTGGAGATAGCGGATACTGTA pLKO.1 1397 CDS 100% 4.950 3.465 N Hexdc n/a
4 TRCN0000182948 CACCAAGATTTCTGTTTCACT pLKO.1 1852 3UTR 100% 3.000 2.100 N Hexdc n/a
5 TRCN0000184611 GAGCACCACATCAGAAACCAT pLKO.1 944 CDS 100% 3.000 2.100 N Hexdc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.