Transcript: Mouse XM_006533452.3

PREDICTED: Mus musculus transmembrane protein 132E (Tmem132e), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem132e (270893)
Length:
6063
CDS:
618..3668

Additional Resources:

NCBI RefSeq record:
XM_006533452.3
NBCI Gene record:
Tmem132e (270893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183229 GCACAATTATATGCGCAGAAT pLKO.1 3724 3UTR 100% 4.950 6.930 N Tmem132e n/a
2 TRCN0000184747 CCCTATACTACCGGTTAGCTA pLKO.1 737 CDS 100% 3.000 4.200 N Tmem132e n/a
3 TRCN0000166715 CCATGGACACAGAGATCATCA pLKO.1 1957 CDS 100% 4.950 3.465 N TMEM132E n/a
4 TRCN0000179341 GCTAGACTTTGAGATGGAGAA pLKO.1 1799 CDS 100% 4.050 2.835 N Tmem132e n/a
5 TRCN0000183777 CCTTTCCAAATCTCATTCCAT pLKO.1 4003 3UTR 100% 3.000 2.100 N Tmem132e n/a
6 TRCN0000184525 GCACTTCACACTTAGGGTGAA pLKO.1 1607 CDS 100% 0.405 0.284 N Tmem132e n/a
7 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2335 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.