Transcript: Mouse XM_006533464.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 8b (Abca8b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca8b (27404)
Length:
2884
CDS:
212..2815

Additional Resources:

NCBI RefSeq record:
XM_006533464.3
NBCI Gene record:
Abca8b (27404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113467 CCAGCATGACACAACAGATAA pLKO.1 459 CDS 100% 13.200 9.240 N Abca8b n/a
2 TRCN0000419202 GATTATCTGTTCCTACTAAAG pLKO_005 1800 CDS 100% 10.800 7.560 N Abca8b n/a
3 TRCN0000113469 GCTCATGTGATTCTTGAAGAT pLKO.1 1553 CDS 100% 4.950 3.465 N Abca8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.