Transcript: Mouse XM_006533469.3

PREDICTED: Mus musculus smoothelin-like 2 (Smtnl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smtnl2 (276829)
Length:
3391
CDS:
215..1267

Additional Resources:

NCBI RefSeq record:
XM_006533469.3
NBCI Gene record:
Smtnl2 (276829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112931 CCTGATGCCTTCGACTACAAT pLKO.1 1064 CDS 100% 5.625 7.875 N Smtnl2 n/a
2 TRCN0000112932 CCTCATTGAAGTGGAGGATAT pLKO.1 1162 CDS 100% 10.800 7.560 N Smtnl2 n/a
3 TRCN0000112930 GCCAAGAAACAGTCTCTAGTT pLKO.1 1845 3UTR 100% 4.950 3.465 N Smtnl2 n/a
4 TRCN0000112933 GCCTCATTGAAGTGGAGGATA pLKO.1 1161 CDS 100% 4.950 3.465 N Smtnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.