Transcript: Mouse XM_006533535.2

PREDICTED: Mus musculus SET and MYND domain containing 4 (Smyd4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Smyd4 (319822)
Length:
3340
CDS:
309..2552

Additional Resources:

NCBI RefSeq record:
XM_006533535.2
NBCI Gene record:
Smyd4 (319822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238344 TGCTTACTGGACTCGTCATTC pLKO_005 2508 CDS 100% 10.800 15.120 N Smyd4 n/a
2 TRCN0000238341 AGACTAAATCCAGTATCTAAA pLKO_005 2769 3UTR 100% 13.200 10.560 N Smyd4 n/a
3 TRCN0000238340 ACCAATGCCTTCGAGGATATA pLKO_005 789 CDS 100% 13.200 9.240 N Smyd4 n/a
4 TRCN0000238342 GGCCTAACACTGAGGACATTT pLKO_005 459 CDS 100% 13.200 9.240 N Smyd4 n/a
5 TRCN0000238343 GGTAGCACAGACACCTGTTTA pLKO_005 1275 CDS 100% 13.200 7.920 N Smyd4 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2886 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2833 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.