Transcript: Mouse XM_006533715.2

PREDICTED: Mus musculus methyltransferase like 2 (Mettl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl2 (52686)
Length:
1200
CDS:
66..977

Additional Resources:

NCBI RefSeq record:
XM_006533715.2
NBCI Gene record:
Mettl2 (52686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097411 CCGGAGAAGCAAGTTGATTAT pLKO.1 255 CDS 100% 13.200 18.480 N Mettl2 n/a
2 TRCN0000445956 GAAGCTCGGTCACCTAGAAAT pLKO_005 533 CDS 100% 13.200 18.480 N Mettl2 n/a
3 TRCN0000452103 CTCTGCCACCTACCGAATACT pLKO_005 578 CDS 100% 5.625 4.500 N Mettl2 n/a
4 TRCN0000441426 ACTTCTACAGAATCCATGAAA pLKO_005 304 CDS 100% 5.625 3.938 N Mettl2 n/a
5 TRCN0000445540 TTGTTCTTTCAGCAATTGTTC pLKO_005 826 CDS 100% 4.950 3.465 N Mettl2 n/a
6 TRCN0000097412 GCTCAAGACAAATTCACAATA pLKO.1 707 CDS 100% 13.200 7.920 N Mettl2 n/a
7 TRCN0000097413 TGCTCAAGACAAATTCACAAT pLKO.1 706 CDS 100% 4.950 2.970 N Mettl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.