Transcript: Mouse XM_006533857.3

PREDICTED: Mus musculus RAB37, member RAS oncogene family (Rab37), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab37 (58222)
Length:
1306
CDS:
656..1216

Additional Resources:

NCBI RefSeq record:
XM_006533857.3
NBCI Gene record:
Rab37 (58222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100817 GACGTGGTGATTATGCTTCTA pLKO.1 1148 CDS 100% 4.950 6.930 N Rab37 n/a
2 TRCN0000100816 CCAGGGAATATGGTGTTCCTT pLKO.1 1259 3UTR 100% 3.000 2.100 N Rab37 n/a
3 TRCN0000381640 CGCAGTGTGACCCATGCTTAT pLKO_005 1022 CDS 100% 10.800 6.480 N Rab37 n/a
4 TRCN0000100818 GCCCAGAGAGACGTGGTGATT pLKO.1 1139 CDS 100% 1.650 0.990 N Rab37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.