Transcript: Mouse XM_006533904.1

PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 10 (March10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
March10 (632687)
Length:
3028
CDS:
316..2682

Additional Resources:

NCBI RefSeq record:
XM_006533904.1
NBCI Gene record:
March10 (632687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255158 TCGCAGTGAAGCAAGATTATC pLKO_005 543 CDS 100% 13.200 18.480 N March10 n/a
2 TRCN0000255159 GTTCAGTATCTACGGGATATG pLKO_005 358 CDS 100% 10.800 15.120 N March10 n/a
3 TRCN0000255160 TCAGAATATCAGGCTTGTTTG pLKO_005 394 CDS 100% 10.800 7.560 N March10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.