Transcript: Mouse XM_006533995.3

PREDICTED: Mus musculus solute carrier family 47, member 1 (Slc47a1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc47a1 (67473)
Length:
2394
CDS:
353..1492

Additional Resources:

NCBI RefSeq record:
XM_006533995.3
NBCI Gene record:
Slc47a1 (67473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174661 GAAATTATGATGACGGATCTT pLKO.1 1286 CDS 100% 4.950 6.930 N Slc47a1 n/a
2 TRCN0000248610 CAAGAAGTCCTCAGCTATTTC pLKO_005 784 CDS 100% 13.200 10.560 N Slc47a1 n/a
3 TRCN0000248607 ATCGTTCTGCCTCAGATTATG pLKO_005 335 5UTR 100% 13.200 9.240 N Slc47a1 n/a
4 TRCN0000173142 CCAAGAAGTCCTCAGCTATTT pLKO.1 783 CDS 100% 13.200 9.240 N Slc47a1 n/a
5 TRCN0000248608 CGTTAATGCCATCGGGTATTA pLKO_005 1018 CDS 100% 13.200 9.240 N Slc47a1 n/a
6 TRCN0000176230 GCTATTTCCTTGATAGTCACA pLKO.1 797 CDS 100% 2.640 1.848 N Slc47a1 n/a
7 TRCN0000248611 TACCTACCAAATACCAGTATT pLKO_005 1814 3UTR 100% 0.000 0.000 N Slc47a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.