Transcript: Mouse XM_006534059.3

PREDICTED: Mus musculus WAS/WASL interacting protein family, member 2 (Wipf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wipf2 (68524)
Length:
6877
CDS:
197..1519

Additional Resources:

NCBI RefSeq record:
XM_006534059.3
NBCI Gene record:
Wipf2 (68524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534059.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184716 CAAGCCTACAACAGGGAGAAA pLKO.1 797 CDS 100% 4.950 6.930 N Wipf2 n/a
2 TRCN0000183399 GCTATTACTTAGTCCCTTTAA pLKO.1 4229 3UTR 100% 13.200 9.240 N Wipf2 n/a
3 TRCN0000029833 GCCACAGAGACACAATTCTTT pLKO.1 1024 CDS 100% 5.625 3.938 N WIPF2 n/a
4 TRCN0000318884 GCCACAGAGACACAATTCTTT pLKO_005 1024 CDS 100% 5.625 3.938 N WIPF2 n/a
5 TRCN0000183848 CACAATTCTTTGCATAGGAAA pLKO.1 1034 CDS 100% 4.950 3.465 N Wipf2 n/a
6 TRCN0000184086 CCTGTGAACATCAGAACAGGA pLKO.1 902 CDS 100% 0.264 0.185 N Wipf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534059.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.