Transcript: Mouse XM_006534178.3

PREDICTED: Mus musculus integrator complex subunit 2 (Ints2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ints2 (70422)
Length:
5649
CDS:
72..3698

Additional Resources:

NCBI RefSeq record:
XM_006534178.3
NBCI Gene record:
Ints2 (70422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247921 ACGTCTTCTAGCAACTAATTA pLKO_005 2213 CDS 100% 15.000 21.000 N Ints2 n/a
2 TRCN0000217674 GGTTCATCAGCAGGATTATAA pLKO.1 4679 3UTR 100% 15.000 21.000 N Ints2 n/a
3 TRCN0000217188 CTACGTCTTCTAGCAACTAAT pLKO.1 2211 CDS 100% 13.200 18.480 N Ints2 n/a
4 TRCN0000257679 CCTTAAGTGATCCGGAATTAA pLKO_005 187 CDS 100% 15.000 12.000 N Ints2 n/a
5 TRCN0000247920 CTCCACTGTATGAGGATATTA pLKO_005 3427 CDS 100% 15.000 10.500 N Ints2 n/a
6 TRCN0000247919 TGGTTCATCAGCAGGATTATA pLKO_005 4678 3UTR 100% 15.000 10.500 N Ints2 n/a
7 TRCN0000416280 GAACAGCAGCTTAGGCATAAA pLKO_005 384 CDS 100% 13.200 9.240 N INTS2 n/a
8 TRCN0000183153 GCACAGGATAAGAAACTTATA pLKO.1 273 CDS 100% 13.200 9.240 N Ints2 n/a
9 TRCN0000257665 TTGACATTGGATCATACTAAA pLKO_005 921 CDS 100% 13.200 9.240 N Ints2 n/a
10 TRCN0000183559 GCTCTACTATATCCTGTCTTA pLKO.1 2033 CDS 100% 4.950 3.465 N Ints2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.