Transcript: Mouse XM_006534380.3

PREDICTED: Mus musculus sedoheptulokinase (Shpk), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Shpk (74637)
Length:
1603
CDS:
388..1350

Additional Resources:

NCBI RefSeq record:
XM_006534380.3
NBCI Gene record:
Shpk (74637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024777 TGGCCGTTGTAACAGTAGTTT pLKO.1 768 CDS 100% 5.625 7.875 N Shpk n/a
2 TRCN0000361877 AGAATCATCCAAGCCCTAAAT pLKO_005 571 CDS 100% 13.200 9.240 N Shpk n/a
3 TRCN0000361936 CAGATGCATGGCATCCTATTT pLKO_005 655 CDS 100% 13.200 9.240 N Shpk n/a
4 TRCN0000024774 GCTGGCACCATTCAAGATTAT pLKO.1 904 CDS 100% 13.200 9.240 N Shpk n/a
5 TRCN0000024775 GCAGGATGTGACTAGAATCAT pLKO.1 558 CDS 100% 5.625 3.938 N Shpk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.