Transcript: Mouse XM_006534689.3

PREDICTED: Mus musculus guanylate binding protein 6 (Gbp6), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gbp6 (100702)
Length:
4320
CDS:
316..1920

Additional Resources:

NCBI RefSeq record:
XM_006534689.3
NBCI Gene record:
Gbp6 (100702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262958 AGAAACACTGATCGAATTAAG pLKO_005 1831 CDS 100% 13.200 6.600 Y Gbp10 n/a
2 TRCN0000262957 AGAAAGCAGCCGACCACTATA pLKO_005 1061 CDS 100% 13.200 6.600 Y Gbp10 n/a
3 TRCN0000262960 ATGATTGAGTCCTTCACATTT pLKO_005 1917 CDS 100% 13.200 6.600 Y Gbp10 n/a
4 TRCN0000262959 GAAGCTATGCAAGTAGTAATT pLKO_005 2034 3UTR 100% 13.200 6.600 Y Gbp10 n/a
5 TRCN0000262961 TTACCTTGTCCGTTATCTAAA pLKO_005 1890 CDS 100% 13.200 6.600 Y Gbp10 n/a
6 TRCN0000115016 GCTGGGAAAGTGACAGTGATA pLKO.1 2804 3UTR 100% 4.950 2.475 Y Gbp6 n/a
7 TRCN0000115019 CTTGTCCGTTATCTAAAGCAT pLKO.1 1894 CDS 100% 3.000 1.500 Y Gbp6 n/a
8 TRCN0000115040 CCAGACTTTGTCTGGACTGTT pLKO.1 598 CDS 100% 0.495 0.248 Y Gbp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.