Transcript: Mouse XM_006534777.3

PREDICTED: Mus musculus ecotropic viral integration site 5 (Evi5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Evi5 (14020)
Length:
3647
CDS:
144..2705

Additional Resources:

NCBI RefSeq record:
XM_006534777.3
NBCI Gene record:
Evi5 (14020)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375441 GTGAAGGAGCTTGTTCGTAAA pLKO_005 561 CDS 100% 10.800 15.120 N Evi5 n/a
2 TRCN0000375448 TGAAGTATGCTAATTGGTAAA pLKO_005 2853 3UTR 100% 10.800 15.120 N Evi5 n/a
3 TRCN0000375449 AGACACAGAACCAGATCAATA pLKO_005 2047 CDS 100% 13.200 9.240 N Evi5 n/a
4 TRCN0000366612 AGGATAAAGTGTTGGATATAG pLKO_005 1729 CDS 100% 13.200 9.240 N Evi5 n/a
5 TRCN0000366543 CACATTGTCAGCCATCTAATA pLKO_005 2451 CDS 100% 13.200 9.240 N Evi5 n/a
6 TRCN0000366613 TTCCACCTACAACGAAGATTT pLKO_005 1631 CDS 100% 13.200 9.240 N Evi5 n/a
7 TRCN0000088225 GCAGGATAAAGTGTTGGATAT pLKO.1 1727 CDS 100% 10.800 7.560 N Evi5 n/a
8 TRCN0000160319 CTTTGTATGTACCAGTTTGAA pLKO.1 960 CDS 100% 5.625 3.938 N EVI5 n/a
9 TRCN0000088227 GAAGCCATTATGGGTTTGAAA pLKO.1 1833 CDS 100% 5.625 3.938 N Evi5 n/a
10 TRCN0000088226 GCTGTGAATGAGTTACAGGAT pLKO.1 1947 CDS 100% 2.640 1.848 N Evi5 n/a
11 TRCN0000088224 CGACAGCAAGTCAGAACCTTA pLKO.1 1860 CDS 100% 4.950 2.970 N Evi5 n/a
12 TRCN0000161062 GCTGAGCTTGAAATCCAGAAA pLKO.1 2280 CDS 100% 4.950 2.970 N EVI5 n/a
13 TRCN0000159840 GCAGAGATTGAATGCAAGAAT pLKO.1 2184 CDS 100% 5.625 3.938 N EVI5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.