Transcript: Mouse XM_006534779.3

PREDICTED: Mus musculus ecotropic viral integration site 5 (Evi5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Evi5 (14020)
Length:
4469
CDS:
231..2708

Additional Resources:

NCBI RefSeq record:
XM_006534779.3
NBCI Gene record:
Evi5 (14020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375441 GTGAAGGAGCTTGTTCGTAAA pLKO_005 564 CDS 100% 10.800 15.120 N Evi5 n/a
2 TRCN0000375448 TGAAGTATGCTAATTGGTAAA pLKO_005 2856 3UTR 100% 10.800 15.120 N Evi5 n/a
3 TRCN0000088223 CCCGCTAAATTCTTGTATTTA pLKO.1 4117 3UTR 100% 1.500 2.100 N Evi5 n/a
4 TRCN0000375449 AGACACAGAACCAGATCAATA pLKO_005 2050 CDS 100% 13.200 9.240 N Evi5 n/a
5 TRCN0000366612 AGGATAAAGTGTTGGATATAG pLKO_005 1732 CDS 100% 13.200 9.240 N Evi5 n/a
6 TRCN0000366543 CACATTGTCAGCCATCTAATA pLKO_005 2454 CDS 100% 13.200 9.240 N Evi5 n/a
7 TRCN0000366613 TTCCACCTACAACGAAGATTT pLKO_005 1634 CDS 100% 13.200 9.240 N Evi5 n/a
8 TRCN0000088225 GCAGGATAAAGTGTTGGATAT pLKO.1 1730 CDS 100% 10.800 7.560 N Evi5 n/a
9 TRCN0000160319 CTTTGTATGTACCAGTTTGAA pLKO.1 963 CDS 100% 5.625 3.938 N EVI5 n/a
10 TRCN0000088227 GAAGCCATTATGGGTTTGAAA pLKO.1 1836 CDS 100% 5.625 3.938 N Evi5 n/a
11 TRCN0000088226 GCTGTGAATGAGTTACAGGAT pLKO.1 1950 CDS 100% 2.640 1.848 N Evi5 n/a
12 TRCN0000088224 CGACAGCAAGTCAGAACCTTA pLKO.1 1863 CDS 100% 4.950 2.970 N Evi5 n/a
13 TRCN0000161062 GCTGAGCTTGAAATCCAGAAA pLKO.1 2283 CDS 100% 4.950 2.970 N EVI5 n/a
14 TRCN0000159840 GCAGAGATTGAATGCAAGAAT pLKO.1 2187 CDS 100% 5.625 3.938 N EVI5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.