Transcript: Mouse XM_006534799.3

PREDICTED: Mus musculus iduronidase, alpha-L- (Idua), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Idua (15932)
Length:
1854
CDS:
100..1338

Additional Resources:

NCBI RefSeq record:
XM_006534799.3
NBCI Gene record:
Idua (15932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340061 ACGTTTCCAAGTGGAACTTTG pLKO_005 15 5UTR 100% 10.800 15.120 N Idua n/a
2 TRCN0000340059 CCGAGTTCGAGCATTGGATTA pLKO_005 1257 CDS 100% 10.800 15.120 N Idua n/a
3 TRCN0000340130 AGGCTGGGCATGGCAATATAT pLKO_005 1673 3UTR 100% 15.000 10.500 N Idua n/a
4 TRCN0000340062 CTCGATTCCAGGTCAACAATA pLKO_005 503 CDS 100% 13.200 9.240 N Idua n/a
5 TRCN0000111257 GTACTCTACTTAGACAATCAA pLKO.1 820 CDS 100% 5.625 3.938 N Idua n/a
6 TRCN0000111259 ACACGTTTCCAAGTGGAACTT pLKO.1 13 5UTR 100% 4.950 3.465 N Idua n/a
7 TRCN0000244416 TCCAAGTGCCTGTGGACATAC pLKO_005 1126 CDS 100% 10.800 7.560 N IDUA n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1827 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534799.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.