Transcript: Mouse XM_006534817.2

PREDICTED: Mus musculus protein phosphatase, EF hand calcium-binding domain 2 (Ppef2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppef2 (19023)
Length:
3488
CDS:
932..3205

Additional Resources:

NCBI RefSeq record:
XM_006534817.2
NBCI Gene record:
Ppef2 (19023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080710 CGGACCTGCTTGTTGAGTTTA pLKO.1 2655 CDS 100% 13.200 18.480 N Ppef2 n/a
2 TRCN0000080711 CCATCTAGTGAACCTACGATA pLKO.1 1660 CDS 100% 4.950 6.930 N Ppef2 n/a
3 TRCN0000080712 GACTCCACATATCGTGCAGTA pLKO.1 2530 CDS 100% 4.050 5.670 N Ppef2 n/a
4 TRCN0000080708 GCCACCACAAAGCATTCAAAT pLKO.1 3291 3UTR 100% 13.200 9.240 N Ppef2 n/a
5 TRCN0000080709 GCGTTTCAGAACGCTGAGAAA pLKO.1 965 CDS 100% 0.495 0.347 N Ppef2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.