Transcript: Mouse XM_006534830.2

PREDICTED: Mus musculus Hermansky-Pudlak syndrome 4 (Hps4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hps4 (192232)
Length:
3353
CDS:
1055..3070

Additional Resources:

NCBI RefSeq record:
XM_006534830.2
NBCI Gene record:
Hps4 (192232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257916 GGAACTGGACTCGTCTGAAAT pLKO_005 2113 CDS 100% 13.200 18.480 N Hps4 n/a
2 TRCN0000217889 GTATGACGGTTCCAAGGTAAA pLKO.1 1114 CDS 100% 10.800 15.120 N Hps4 n/a
3 TRCN0000249662 GTATGACGGTTCCAAGGTAAA pLKO_005 1114 CDS 100% 10.800 15.120 N Hps4 n/a
4 TRCN0000189449 CGAATCGCACAGGATCTTCAA pLKO.1 1507 CDS 100% 4.950 6.930 N Hps4 n/a
5 TRCN0000200539 CACATACAACTTCCTTCATTA pLKO.1 2743 CDS 100% 13.200 9.240 N Hps4 n/a
6 TRCN0000249661 ACCTCATGCACTCCGACTTTG pLKO_005 2844 CDS 100% 10.800 7.560 N Hps4 n/a
7 TRCN0000257940 ATACCCTCCCTGGGATCAAAG pLKO_005 1879 CDS 100% 10.800 7.560 N Hps4 n/a
8 TRCN0000249660 TGGGTGCAGCTTGCATATCAC pLKO_005 3073 3UTR 100% 4.950 3.465 N Hps4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.