Transcript: Mouse XM_006534878.1

PREDICTED: Mus musculus transmembrane protein 150C (Tmem150c), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem150c (231503)
Length:
2824
CDS:
94..843

Additional Resources:

NCBI RefSeq record:
XM_006534878.1
NBCI Gene record:
Tmem150c (231503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176831 GCAGGTTACTTCTTTCTTGAA pLKO.1 1003 3UTR 100% 4.950 6.930 N Tmem150c n/a
2 TRCN0000182255 CCCTGAAGTATAGCTTCCCAA pLKO.1 2263 3UTR 100% 2.640 3.696 N Tmem150c n/a
3 TRCN0000197835 GAATGACCTTACTTGGTAATT pLKO.1 431 CDS 100% 13.200 9.240 N Tmem150c n/a
4 TRCN0000176991 GCTTGTGGATAGTGTACTTTA pLKO.1 161 CDS 100% 13.200 9.240 N Tmem150c n/a
5 TRCN0000197819 GCACACAGTAAATGTCCAAAT pLKO.1 2335 3UTR 100% 10.800 7.560 N Tmem150c n/a
6 TRCN0000182591 GCCTGTCAGAAGCTTCTGAAT pLKO.1 803 CDS 100% 0.495 0.347 N Tmem150c n/a
7 TRCN0000216881 GTTTCTACCTCTCGTGTTTAC pLKO.1 123 CDS 100% 10.800 6.480 N Tmem150c n/a
8 TRCN0000269204 TAGCTGTTCTGCGCTTCATAC pLKO_005 338 CDS 100% 10.800 7.560 N TMEM150C n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 941 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.