Transcript: Mouse XM_006534887.2

PREDICTED: Mus musculus Rho GTPase activating protein 24 (Arhgap24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap24 (231532)
Length:
10737
CDS:
786..3029

Additional Resources:

NCBI RefSeq record:
XM_006534887.2
NBCI Gene record:
Arhgap24 (231532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362114 AGCGATAACAGCGAGACATTC pLKO_005 2661 CDS 100% 10.800 15.120 N Arhgap24 n/a
2 TRCN0000023918 CGTCGTTCCTTATGCAAAGTA pLKO.1 1442 CDS 100% 5.625 7.875 N Arhgap24 n/a
3 TRCN0000023915 CGAGTATGAGTCCAGGATAAA pLKO.1 2762 CDS 100% 13.200 10.560 N Arhgap24 n/a
4 TRCN0000362113 AGTCCATCCGCCGAGTCATAT pLKO_005 1132 CDS 100% 13.200 9.240 N Arhgap24 n/a
5 TRCN0000023914 GCAGTCCTATTCAGGAGTTAA pLKO.1 1601 CDS 100% 13.200 9.240 N Arhgap24 n/a
6 TRCN0000368828 TAAGAGTAAGAAGCATATATC pLKO_005 3276 3UTR 100% 13.200 9.240 N Arhgap24 n/a
7 TRCN0000023916 CCAGCAGTTAATGTCAGTGAT pLKO.1 1721 CDS 100% 4.950 3.465 N Arhgap24 n/a
8 TRCN0000023917 CCCAAGGAACAGTATCCACAA pLKO.1 1988 CDS 100% 4.050 2.835 N Arhgap24 n/a
9 TRCN0000424612 GACTCTCCACCTACGACAATG pLKO_005 2365 CDS 100% 10.800 6.480 N ARHGAP22 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6941 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.