Transcript: Mouse XM_006534968.2

PREDICTED: Mus musculus shroom family member 3 (Shroom3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shroom3 (27428)
Length:
6152
CDS:
148..5565

Additional Resources:

NCBI RefSeq record:
XM_006534968.2
NBCI Gene record:
Shroom3 (27428)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306901 CGGGTTCCATGGACGTGATTT pLKO_005 470 CDS 100% 13.200 9.240 N Shroom3 n/a
2 TRCN0000098210 CTCACCACTGTTCAATCTGAA pLKO.1 5600 3UTR 100% 4.950 3.465 N Shroom3 n/a
3 TRCN0000288291 CTCACCACTGTTCAATCTGAA pLKO_005 5600 3UTR 100% 4.950 3.465 N Shroom3 n/a
4 TRCN0000098212 GCTAGTCAAAGAGAGTGGATA pLKO.1 1104 CDS 100% 4.950 3.465 N Shroom3 n/a
5 TRCN0000288232 GCTAGTCAAAGAGAGTGGATA pLKO_005 1104 CDS 100% 4.950 3.465 N Shroom3 n/a
6 TRCN0000098213 CGGATCATCTGAAGCAACGTA pLKO.1 3575 CDS 100% 3.000 2.100 N Shroom3 n/a
7 TRCN0000288231 CGGATCATCTGAAGCAACGTA pLKO_005 3575 CDS 100% 3.000 2.100 N Shroom3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5933 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.