Transcript: Mouse XM_006535228.3

PREDICTED: Mus musculus WD repeat and FYVE domain containing 3 (Wdfy3), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdfy3 (72145)
Length:
9845
CDS:
779..9718

Additional Resources:

NCBI RefSeq record:
XM_006535228.3
NBCI Gene record:
Wdfy3 (72145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311327 TATGGCCGACAACGCTAATTA pLKO_005 2011 CDS 100% 15.000 21.000 N Wdfy3 n/a
2 TRCN0000111646 GCGCCCACAATATAGTGAAAT pLKO.1 2502 CDS 100% 13.200 18.480 N Wdfy3 n/a
3 TRCN0000111649 CGCCACTACTTTACAGTACAT pLKO.1 4981 CDS 100% 4.950 3.960 N Wdfy3 n/a
4 TRCN0000305435 CTCGCTCACTGCCTGATTAAT pLKO_005 7208 CDS 100% 15.000 10.500 N Wdfy3 n/a
5 TRCN0000305492 TTCTAGCGTGACTACTATTTA pLKO_005 4609 CDS 100% 15.000 10.500 N Wdfy3 n/a
6 TRCN0000111647 GCCAAGTTGATGAGGGAATTT pLKO.1 5387 CDS 100% 13.200 9.240 N Wdfy3 n/a
7 TRCN0000240702 CGGATATGGCAAGGATATAAT pLKO_005 1691 CDS 100% 15.000 21.000 N WDFY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.