Transcript: Mouse XM_006535297.2

PREDICTED: Mus musculus predicted gene 7792 (Gm7792), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7792 (665802)
Length:
1632
CDS:
67..1512

Additional Resources:

NCBI RefSeq record:
XM_006535297.2
NBCI Gene record:
Gm7792 (665802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255001 CCATCACTCACTGCCTAATTT pLKO_005 974 CDS 100% 15.000 7.500 Y Gm16367 n/a
2 TRCN0000255000 ATTATTTGCTCTCGATCTTAT pLKO_005 1071 CDS 100% 13.200 6.600 Y Gm16367 n/a
3 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 1293 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
4 TRCN0000262970 CATCACTCACTGCCTAATTTC pLKO_005 975 CDS 100% 13.200 6.600 Y Gm3286 n/a
5 TRCN0000269549 TCCATCACTCACTGCCTAATT pLKO_005 973 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
6 TRCN0000262968 TCTGTTGCGGCTGGCACATTT pLKO_005 714 CDS 100% 13.200 6.600 Y Gm3286 n/a
7 TRCN0000269613 CAATCAGTTCTCAGCTCAATG pLKO_005 527 CDS 100% 10.800 5.400 Y E330014E10Rik n/a
8 TRCN0000254999 GGCAGCGTCTGAAGATCATAG pLKO_005 497 CDS 100% 10.800 5.400 Y Gm16367 n/a
9 TRCN0000175000 GAGAAAGATTTGTGGAACTTT pLKO.1 1358 CDS 100% 5.625 2.813 Y D5Ertd577e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.