Transcript: Mouse XM_006535331.3

PREDICTED: Mus musculus ring finger protein 212 (Rnf212), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf212 (671564)
Length:
1928
CDS:
133..1080

Additional Resources:

NCBI RefSeq record:
XM_006535331.3
NBCI Gene record:
Rnf212 (671564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178434 GATGGATACTGAGAAGATGAG pLKO.1 963 CDS 100% 4.050 2.835 N Rnf212 n/a
2 TRCN0000197921 GTTTCAACAAAGCCAAATGGA pLKO.1 541 CDS 100% 3.000 2.100 N Rnf212 n/a
3 TRCN0000182721 CTCTGTGATTAGTCCACCTCA pLKO.1 672 CDS 100% 2.640 1.848 N Rnf212 n/a
4 TRCN0000177987 GATATCTCTTTCTACCACCCA pLKO.1 560 CDS 100% 0.660 0.462 N Rnf212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.