Transcript: Mouse XM_006535402.1

PREDICTED: Mus musculus fragile X mental retardation gene 1, autosomal homolog (Fxr1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fxr1 (14359)
Length:
2809
CDS:
56..1762

Additional Resources:

NCBI RefSeq record:
XM_006535402.1
NBCI Gene record:
Fxr1 (14359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421765 ACCTCCGGTTATGGTACAAAT pLKO_005 1328 CDS 100% 13.200 18.480 N FXR1 n/a
2 TRCN0000294575 AGTATCACATCGCTTACTTAA pLKO_005 1110 CDS 100% 13.200 18.480 N Fxr1 n/a
3 TRCN0000102547 CCGTTTAATGAAGTGCGATTA pLKO.1 182 CDS 100% 10.800 15.120 N Fxr1 n/a
4 TRCN0000287106 CCGTTTAATGAAGTGCGATTA pLKO_005 182 CDS 100% 10.800 15.120 N Fxr1 n/a
5 TRCN0000294517 GAACGCATGGCAGTAACATAC pLKO_005 759 CDS 100% 10.800 15.120 N Fxr1 n/a
6 TRCN0000102548 CCCTAATTACACCTCCGGTTA pLKO.1 1318 CDS 100% 4.050 5.670 N Fxr1 n/a
7 TRCN0000102546 CGAAACAGAATCTGAGCGTAA pLKO.1 1369 CDS 100% 4.050 5.670 N Fxr1 n/a
8 TRCN0000158932 GCTAGAGGTTTCTTGGAATTT pLKO.1 878 CDS 100% 13.200 9.240 N FXR1 n/a
9 TRCN0000159365 GCTAAAGTTCGGATGATGAAA pLKO.1 299 CDS 100% 5.625 3.938 N FXR1 n/a
10 TRCN0000102549 CGGATGATGAAAGGCGAGTTT pLKO.1 308 CDS 100% 4.950 3.465 N Fxr1 n/a
11 TRCN0000287161 CGGATGATGAAAGGCGAGTTT pLKO_005 308 CDS 100% 4.950 3.465 N Fxr1 n/a
12 TRCN0000102545 GCCAGTCTTACATCGCACTTT pLKO.1 2002 3UTR 100% 4.950 3.465 N Fxr1 n/a
13 TRCN0000287162 GCCAGTCTTACATCGCACTTT pLKO_005 2002 3UTR 100% 4.950 3.465 N Fxr1 n/a
14 TRCN0000166775 CCAGAAATGAAGAGGCCACTA pLKO.1 654 CDS 100% 4.050 2.835 N FXR1 n/a
15 TRCN0000159108 GCACTAAAGAAAGCATTGGAA pLKO.1 1071 CDS 100% 3.000 2.100 N FXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.