Transcript: Mouse XM_006535635.3

PREDICTED: Mus musculus potassium voltage-gated channel, subfamily H (eag-related), member 2 (Kcnh2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnh2 (16511)
Length:
3979
CDS:
253..3564

Additional Resources:

NCBI RefSeq record:
XM_006535635.3
NBCI Gene record:
Kcnh2 (16511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068386 CCTCAACTTTGAAGTAGTGAT pLKO.1 453 CDS 100% 4.950 3.960 N Kcnh2 n/a
2 TRCN0000068385 CCCTCCATCAAGGACAAGTAT pLKO.1 1894 CDS 100% 5.625 3.938 N Kcnh2 n/a
3 TRCN0000068384 CCTTCGAGATACCAACATGAT pLKO.1 2664 CDS 100% 4.950 3.465 N Kcnh2 n/a
4 TRCN0000068383 CCGCAAGTTCATCATCGCTAA pLKO.1 153 5UTR 100% 4.050 2.835 N Kcnh2 n/a
5 TRCN0000068387 CTGCACAAGATCCATCGTGAT pLKO.1 2569 CDS 100% 4.050 2.430 N Kcnh2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.