Transcript: Mouse XM_006535728.3

PREDICTED: Mus musculus F-box and leucine-rich repeat protein 13 (Fbxl13), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl13 (320118)
Length:
2811
CDS:
160..2724

Additional Resources:

NCBI RefSeq record:
XM_006535728.3
NBCI Gene record:
Fbxl13 (320118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441320 CAAGTTAGGGAAGCCGATTAG pLKO_005 801 CDS 100% 10.800 15.120 N Fbxl13 n/a
2 TRCN0000092150 CGGTTGCGACATTTGTTCTAT pLKO.1 664 CDS 100% 5.625 7.875 N Fbxl13 n/a
3 TRCN0000092151 CCCTAATTTACACTACTTGAA pLKO.1 1923 CDS 100% 4.950 6.930 N Fbxl13 n/a
4 TRCN0000092152 CGGCTAAACGTGCTGCGTTTA pLKO.1 1069 CDS 100% 1.080 1.512 N Fbxl13 n/a
5 TRCN0000440539 GGCGCATAGCATTTGACATTT pLKO_005 860 CDS 100% 13.200 9.240 N Fbxl13 n/a
6 TRCN0000092148 GCAAGCATGTTATCCTTGATA pLKO.1 1990 CDS 100% 5.625 3.938 N Fbxl13 n/a
7 TRCN0000092149 GCCAGTCTTTCACAGATGAAT pLKO.1 1175 CDS 100% 5.625 3.938 N Fbxl13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.