Transcript: Mouse XM_006536177.3

PREDICTED: Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain (Sigirr), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sigirr (24058)
Length:
2157
CDS:
765..1994

Additional Resources:

NCBI RefSeq record:
XM_006536177.3
NBCI Gene record:
Sigirr (24058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101197 GCTCTATGTTAAGTGTCGGCT pLKO.1 1172 CDS 100% 0.660 0.924 N Sigirr n/a
2 TRCN0000309773 GCTCTATGTTAAGTGTCGGCT pLKO_005 1172 CDS 100% 0.660 0.924 N Sigirr n/a
3 TRCN0000101199 TGGCAGAGAAGTTGCTTTGAA pLKO.1 836 CDS 100% 5.625 3.938 N Sigirr n/a
4 TRCN0000309694 TGGCAGAGAAGTTGCTTTGAA pLKO_005 836 CDS 100% 5.625 3.938 N Sigirr n/a
5 TRCN0000101196 CTGGTGCTCAACTTGACCAAT pLKO.1 1008 CDS 100% 4.950 3.465 N Sigirr n/a
6 TRCN0000309695 CTGGTGCTCAACTTGACCAAT pLKO_005 1008 CDS 100% 4.950 3.465 N Sigirr n/a
7 TRCN0000101195 GCTGAAAGATGGTCTGGCATT pLKO.1 911 CDS 100% 4.050 2.835 N Sigirr n/a
8 TRCN0000309692 GCTGAAAGATGGTCTGGCATT pLKO_005 911 CDS 100% 4.050 2.835 N Sigirr n/a
9 TRCN0000101198 CAGACCTATCTTCATCACCTT pLKO.1 1523 CDS 100% 2.640 1.848 N Sigirr n/a
10 TRCN0000309693 CAGACCTATCTTCATCACCTT pLKO_005 1523 CDS 100% 2.640 1.848 N Sigirr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.