Transcript: Mouse XM_006536228.3

PREDICTED: Mus musculus Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 (Rassf7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rassf7 (66985)
Length:
1460
CDS:
24..1103

Additional Resources:

NCBI RefSeq record:
XM_006536228.3
NBCI Gene record:
Rassf7 (66985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294857 ATAGGCCAGACAGGTCGATTT pLKO_005 144 CDS 100% 10.800 15.120 N Rassf7 n/a
2 TRCN0000294790 CAACTGTTATCCTAGTCTTTC pLKO_005 1253 3UTR 100% 10.800 7.560 N Rassf7 n/a
3 TRCN0000039133 CAGGACCTTCTGTCTCCAAAT pLKO.1 990 CDS 100% 10.800 7.560 N Rassf7 n/a
4 TRCN0000298320 CAGGACCTTCTGTCTCCAAAT pLKO_005 990 CDS 100% 10.800 7.560 N Rassf7 n/a
5 TRCN0000039130 ACCTGCCAAGAAGTGGTCATT pLKO.1 108 CDS 100% 4.950 3.465 N Rassf7 n/a
6 TRCN0000039132 CAAGAGCTGCAACGAGAACAA pLKO.1 567 CDS 100% 4.950 3.465 N Rassf7 n/a
7 TRCN0000287365 CAAGAGCTGCAACGAGAACAA pLKO_005 567 CDS 100% 4.950 3.465 N Rassf7 n/a
8 TRCN0000039131 GTTTGCCAATGATGTTCAGTT pLKO.1 248 CDS 100% 4.950 3.465 N Rassf7 n/a
9 TRCN0000422277 TGAGGCCTTCTGGGAGCAAGA pLKO_005 551 CDS 100% 1.350 0.945 N RASSF7 n/a
10 TRCN0000039129 CTGTCTCCAAATAGAGGAGAA pLKO.1 999 CDS 100% 0.405 0.284 N Rassf7 n/a
11 TRCN0000307431 ACCTCCACAGCTGGATAGAAC pLKO_005 956 CDS 100% 4.950 2.970 N Rassf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.