Transcript: Mouse XM_006537453.2

PREDICTED: Mus musculus histocompatibility 2, T region locus 23 (H2-T23), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-T23 (15040)
Length:
1535
CDS:
55..1083

Additional Resources:

NCBI RefSeq record:
XM_006537453.2
NBCI Gene record:
H2-T23 (15040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348865 AGATCTCTAAGCACAAGTCAG pLKO_005 536 CDS 100% 4.050 2.835 N H2-T23 n/a
2 TRCN0000067544 CGGCTACTACAATCAGAGTAA pLKO.1 360 CDS 100% 4.950 2.475 Y H2-T23 n/a
3 TRCN0000067545 CCAGGATTACATCTCCCTGAA pLKO.1 474 CDS 100% 4.050 2.025 Y H2-T23 n/a
4 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 1193 3UTR 100% 2.640 1.320 Y P3h3 n/a
5 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 1193 3UTR 100% 2.640 1.320 Y P3h3 n/a
6 TRCN0000067546 GCTATGCTCATGTTCTAGGCA pLKO.1 1066 CDS 100% 0.750 0.375 Y H2-T23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.