Transcript: Mouse XM_006537556.1

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 1 (Abca1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca1 (11303)
Length:
10277
CDS:
414..7130

Additional Resources:

NCBI RefSeq record:
XM_006537556.1
NBCI Gene record:
Abca1 (11303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271812 GGCAAGGCCGCACCATTATTT pLKO_005 3649 CDS 100% 15.000 21.000 N Abca1 n/a
2 TRCN0000113424 CCCGGTGTTGTTGGAAACTTT pLKO.1 684 CDS 100% 5.625 7.875 N Abca1 n/a
3 TRCN0000113420 CGCTAGATATACCTAGCATAA pLKO.1 9628 3UTR 100% 1.080 1.512 N Abca1 n/a
4 TRCN0000271860 GAGTGCCACTTTCCGAATAAA pLKO_005 570 CDS 100% 15.000 10.500 N Abca1 n/a
5 TRCN0000271859 TAGTCCTCTTTCTCGAATTAT pLKO_005 1505 CDS 100% 15.000 10.500 N Abca1 n/a
6 TRCN0000113421 CCGGTGTTGTTGGAAACTTTA pLKO.1 685 CDS 100% 13.200 9.240 N Abca1 n/a
7 TRCN0000113422 CCTGTTATGTTGATGACATTT pLKO.1 2287 CDS 100% 13.200 9.240 N Abca1 n/a
8 TRCN0000271858 GCCTACTTGATAGCATCAATA pLKO_005 8550 3UTR 100% 13.200 9.240 N Abca1 n/a
9 TRCN0000113423 GCCTGGTAAAGTATGGAGAAA pLKO.1 6442 CDS 100% 4.950 3.465 N Abca1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.