Transcript: Mouse XM_006537584.3

PREDICTED: Mus musculus cadherin 17 (Cdh17), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh17 (12557)
Length:
3388
CDS:
83..2566

Additional Resources:

NCBI RefSeq record:
XM_006537584.3
NBCI Gene record:
Cdh17 (12557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094706 CGGGAGAGACAGATGGTATAT pLKO.1 267 CDS 100% 13.200 10.560 N Cdh17 n/a
2 TRCN0000318032 CGGGAGAGACAGATGGTATAT pLKO_005 267 CDS 100% 13.200 10.560 N Cdh17 n/a
3 TRCN0000094704 GCTGTTATCTATCACCAAATT pLKO.1 2936 3UTR 100% 13.200 10.560 N Cdh17 n/a
4 TRCN0000349535 GCTGTTATCTATCACCAAATT pLKO_005 2936 3UTR 100% 13.200 10.560 N Cdh17 n/a
5 TRCN0000094705 GCAGGATATGTCAAGATCAAA pLKO.1 1607 CDS 100% 5.625 4.500 N Cdh17 n/a
6 TRCN0000318034 GCAGGATATGTCAAGATCAAA pLKO_005 1607 CDS 100% 5.625 4.500 N Cdh17 n/a
7 TRCN0000094708 CCAGCGAATATTCCAAGCAAA pLKO.1 1780 CDS 100% 4.950 3.960 N Cdh17 n/a
8 TRCN0000094707 GCTAACAACATCAACAGTATT pLKO.1 1187 CDS 100% 13.200 9.240 N Cdh17 n/a
9 TRCN0000318033 GCTAACAACATCAACAGTATT pLKO_005 1187 CDS 100% 13.200 9.240 N Cdh17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.