Transcript: Mouse XM_006537646.3

PREDICTED: Mus musculus multiple PDZ domain protein (Mpdz), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpdz (17475)
Length:
7562
CDS:
334..6444

Additional Resources:

NCBI RefSeq record:
XM_006537646.3
NBCI Gene record:
Mpdz (17475)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313272 GACTAAGAACAGTCGAAATAA pLKO_005 5807 CDS 100% 15.000 21.000 N Mpdz n/a
2 TRCN0000313274 GCTCGGAGATGTCCCTATATT pLKO_005 5883 CDS 100% 15.000 21.000 N Mpdz n/a
3 TRCN0000313273 TCTCGACAATATCTAACAATT pLKO_005 6664 3UTR 100% 13.200 18.480 N Mpdz n/a
4 TRCN0000103484 CATCTGAAATTCAGGGACTAA pLKO.1 5792 CDS 100% 4.950 3.960 N Mpdz n/a
5 TRCN0000313275 GAATAATGGCACTGGATATTT pLKO_005 3659 CDS 100% 15.000 10.500 N Mpdz n/a
6 TRCN0000103482 GCCTTCAGGAATCTTTGTAAA pLKO.1 1539 CDS 100% 13.200 9.240 N Mpdz n/a
7 TRCN0000349430 GCCTTCAGGAATCTTTGTAAA pLKO_005 1539 CDS 100% 13.200 9.240 N Mpdz n/a
8 TRCN0000103480 CGCACCAGAATGAGTGTGTTT pLKO.1 4348 CDS 100% 4.950 3.465 N Mpdz n/a
9 TRCN0000103483 GCATCTGAAATTCAGGGACTA pLKO.1 5791 CDS 100% 4.050 2.835 N Mpdz n/a
10 TRCN0000103481 GCTCTGATAGATACACCTGAT pLKO.1 2788 CDS 100% 4.050 2.835 N Mpdz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.