Transcript: Mouse XM_006537674.3

PREDICTED: Mus musculus paired box 5 (Pax5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pax5 (18507)
Length:
7924
CDS:
1836..2687

Additional Resources:

NCBI RefSeq record:
XM_006537674.3
NBCI Gene record:
Pax5 (18507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537674.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085640 CGCAAGAGGGATGAAGGTATT pLKO.1 2100 CDS 100% 10.800 8.640 N Pax5 n/a
2 TRCN0000420741 ATGGTGCCTGGGAGTGAATTT pLKO_005 2514 CDS 100% 13.200 9.240 N Pax5 n/a
3 TRCN0000085642 ACAGCACTACTCTGACATCTT pLKO.1 2240 CDS 100% 4.950 3.465 N Pax5 n/a
4 TRCN0000085638 CGCCAAAGGATAGTGGAACTT pLKO.1 1623 5UTR 100% 4.950 3.465 N Pax5 n/a
5 TRCN0000428804 GCTTCCAGTCACAGCATAGTG pLKO_005 1968 CDS 100% 4.950 3.465 N Pax5 n/a
6 TRCN0000412527 TCGCTGAGTACAAACGCCAAA pLKO_005 1807 5UTR 100% 4.050 2.835 N Pax5 n/a
7 TRCN0000085639 CCTGGATGACATGAAAGCCAA pLKO.1 2330 CDS 100% 2.640 1.848 N Pax5 n/a
8 TRCN0000085641 CTCATACTCCATCAGTGGCAT pLKO.1 2042 CDS 100% 2.640 1.848 N Pax5 n/a
9 TRCN0000016060 GCAGGTATTATGAGACAGGAA pLKO.1 1720 5UTR 100% 2.640 1.848 N PAX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537674.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.