Transcript: Mouse XM_006537768.3

PREDICTED: Mus musculus talin 1 (Tln1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tln1 (21894)
Length:
8233
CDS:
115..7791

Additional Resources:

NCBI RefSeq record:
XM_006537768.3
NBCI Gene record:
Tln1 (21894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108755 CGCTCCAAGAGTATTATTAAT pLKO.1 8024 3UTR 100% 15.000 21.000 N Tln1 n/a
2 TRCN0000287263 CGCTCCAAGAGTATTATTAAT pLKO_005 8024 3UTR 100% 15.000 21.000 N Tln1 n/a
3 TRCN0000294832 GCGCTCACTGGAACCATTAAC pLKO_005 1594 CDS 100% 13.200 10.560 N Tln1 n/a
4 TRCN0000294830 TCCGAATGACCAAGGGTATTA pLKO_005 6692 CDS 100% 13.200 9.240 N Tln1 n/a
5 TRCN0000294831 TGGTGAAGACGATGCAATTTG pLKO_005 152 CDS 100% 13.200 9.240 N Tln1 n/a
6 TRCN0000108757 GCCACCAACAATCTGTGTGAA pLKO.1 7372 CDS 100% 4.950 3.465 N Tln1 n/a
7 TRCN0000108756 GCCCATTGTAATCTCTGCTAA pLKO.1 4956 CDS 100% 4.950 3.465 N Tln1 n/a
8 TRCN0000287262 GCCCATTGTAATCTCTGCTAA pLKO_005 4956 CDS 100% 4.950 3.465 N Tln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537768.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.