Transcript: Mouse XM_006537789.3

PREDICTED: Mus musculus unc-13 homolog B (C. elegans) (Unc13b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc13b (22249)
Length:
7729
CDS:
938..6886

Additional Resources:

NCBI RefSeq record:
XM_006537789.3
NBCI Gene record:
Unc13b (22249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244619 CAACTCTTCTGATCGAATTAA pLKO_005 4024 CDS 100% 15.000 10.500 N Unc13b n/a
2 TRCN0000244620 GCCAACATCAATGCCTATTAT pLKO_005 4532 CDS 100% 15.000 10.500 N Unc13b n/a
3 TRCN0000244621 GAAGATCCGAGAACGGAATAA pLKO_005 3721 CDS 100% 13.200 9.240 N Unc13b n/a
4 TRCN0000244618 TTAGAGTCCTTGTAGTCAAAT pLKO_005 6972 3UTR 100% 13.200 9.240 N Unc13b n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7632 3UTR 100% 4.950 2.475 Y KAAG1 n/a
6 TRCN0000002356 CTCTCTACATACAGGAATAAT pLKO.1 4670 CDS 100% 15.000 12.000 N UNC13B n/a
7 TRCN0000320384 CTCTCTACATACAGGAATAAT pLKO_005 4670 CDS 100% 15.000 12.000 N UNC13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.