Transcript: Mouse XM_006537857.3

PREDICTED: Mus musculus RIKEN cDNA E130308A19 gene (E130308A19Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
E130308A19Rik (230259)
Length:
7043
CDS:
166..2433

Additional Resources:

NCBI RefSeq record:
XM_006537857.3
NBCI Gene record:
E130308A19Rik (230259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182603 GTCCCAAGAGAGGGTTTGTTT pLKO.1 366 CDS 100% 5.625 7.875 N E130308A19Rik n/a
2 TRCN0000129319 CCTCAAAGCATTGCTCGCAAA pLKO.1 664 CDS 100% 4.050 3.240 N KIAA1958 n/a
3 TRCN0000200289 GAAGCTGTCGAGGAGTATGAA pLKO.1 562 CDS 100% 5.625 3.938 N E130308A19Rik n/a
4 TRCN0000177096 CAAACCTGAAACACTTGCTTT pLKO.1 254 CDS 100% 4.950 3.465 N E130308A19Rik n/a
5 TRCN0000127558 CCTCCTCTACAAGTACATGTA pLKO.1 2175 CDS 100% 4.950 3.465 N KIAA1958 n/a
6 TRCN0000182808 GCTGTCGAGGAGTATGAAGAT pLKO.1 565 CDS 100% 4.950 3.465 N E130308A19Rik n/a
7 TRCN0000130579 CCTGAAACACTTGCTTTCTGA pLKO.1 258 CDS 100% 3.000 2.100 N KIAA1958 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537857.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.