Transcript: Mouse XM_006537899.3

PREDICTED: Mus musculus mannosidase, endo-alpha (Manea), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Manea (242362)
Length:
1989
CDS:
202..1590

Additional Resources:

NCBI RefSeq record:
XM_006537899.3
NBCI Gene record:
Manea (242362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215793 CAATATGGGCCAATCTGTTAA pLKO.1 1028 CDS 100% 13.200 18.480 N Manea n/a
2 TRCN0000216070 CCTCATAAGCCAAGTCTTTAT pLKO.1 1486 CDS 100% 13.200 18.480 N Manea n/a
3 TRCN0000242024 ATAGTCCTCCAGACGACATTG pLKO_005 632 CDS 100% 10.800 15.120 N Manea n/a
4 TRCN0000242022 ACATCACAAAGCCTACAATAT pLKO_005 1013 CDS 100% 13.200 9.240 N Manea n/a
5 TRCN0000215551 GTATTATGAAGTTGGTCTAAG pLKO.1 1341 CDS 100% 10.800 7.560 N Manea n/a
6 TRCN0000242025 GTGTAGGCCCAGGATACATAG pLKO_005 1265 CDS 100% 10.800 7.560 N Manea n/a
7 TRCN0000184786 CCTCGGATAGCCAAGAACTAT pLKO.1 598 CDS 100% 5.625 3.938 N Manea n/a
8 TRCN0000179691 GCCCAGGATACATAGATACAA pLKO.1 1271 CDS 100% 5.625 3.938 N Manea n/a
9 TRCN0000242021 CCAGAACTTCATCCACTAAAT pLKO_005 337 CDS 100% 13.200 7.920 N Manea n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.