Transcript: Mouse XM_006537950.1

PREDICTED: Mus musculus caspase 8 associated protein 2 (Casp8ap2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Casp8ap2 (26885)
Length:
6695
CDS:
55..6069

Additional Resources:

NCBI RefSeq record:
XM_006537950.1
NBCI Gene record:
Casp8ap2 (26885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350090 GTATGGGATGCCAGGTAATAT pLKO_005 5399 CDS 100% 15.000 21.000 N Casp8ap2 n/a
2 TRCN0000103557 CCCAAGAATGACGTGAAACAT pLKO.1 1339 CDS 100% 5.625 7.875 N Casp8ap2 n/a
3 TRCN0000103556 GCCTCAAATAAGGTGGTTCAT pLKO.1 5014 CDS 100% 4.950 6.930 N Casp8ap2 n/a
4 TRCN0000103559 CGTAAGGATGAAGAGATAAAT pLKO.1 562 CDS 100% 15.000 12.000 N Casp8ap2 n/a
5 TRCN0000317888 CGTAAGGATGAAGAGATAAAT pLKO_005 562 CDS 100% 15.000 12.000 N Casp8ap2 n/a
6 TRCN0000314043 GGCATAGTTGACCGTTTATTT pLKO_005 3466 CDS 100% 15.000 10.500 N Casp8ap2 n/a
7 TRCN0000314093 TTGCTTGTGGCACGGAAATTT pLKO_005 2147 CDS 100% 15.000 10.500 N Casp8ap2 n/a
8 TRCN0000061767 CCAGTCTCTTAAGAAGAATAT pLKO.1 504 CDS 100% 13.200 9.240 N CASP8AP2 n/a
9 TRCN0000314042 GGTCATTGTGCTTGGTGTATT pLKO_005 6243 3UTR 100% 13.200 9.240 N Casp8ap2 n/a
10 TRCN0000103558 CCCAGAGACTTAGTCCCAATT pLKO.1 5699 CDS 100% 10.800 7.560 N Casp8ap2 n/a
11 TRCN0000103555 CCTGTTATTGGTCAGAATGTT pLKO.1 6288 3UTR 100% 5.625 3.938 N Casp8ap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.