Transcript: Mouse XM_006537986.3

PREDICTED: Mus musculus zinc finger, CCHC domain containing 7 (Zcchc7), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zcchc7 (319885)
Length:
1987
CDS:
67..1251

Additional Resources:

NCBI RefSeq record:
XM_006537986.3
NBCI Gene record:
Zcchc7 (319885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339292 GTGCACAGAAAGGCCATTATG pLKO_005 668 CDS 100% 13.200 18.480 N Zcchc7 n/a
2 TRCN0000339223 GTGACCGATGTGATATGATAG pLKO_005 527 CDS 100% 10.800 15.120 N Zcchc7 n/a
3 TRCN0000191260 CCGATACTATTCAGTCAACAA pLKO.1 306 CDS 100% 4.950 6.930 N Zcchc7 n/a
4 TRCN0000339220 CCGATACTATTCAGTCAACAA pLKO_005 306 CDS 100% 4.950 6.930 N Zcchc7 n/a
5 TRCN0000178999 CGAATGTTTAACCAGACGTTT pLKO.1 709 CDS 100% 4.950 6.930 N Zcchc7 n/a
6 TRCN0000183002 CATATATTGCTATGATGGCAA pLKO.1 744 CDS 100% 2.640 3.696 N Zcchc7 n/a
7 TRCN0000181010 GCAAAGGGATCGGAGAATAAA pLKO.1 777 CDS 100% 15.000 12.000 N Zcchc7 n/a
8 TRCN0000215988 CTCATTGGAAGAAAGTTTATT pLKO.1 1513 3UTR 100% 15.000 10.500 N Zcchc7 n/a
9 TRCN0000215929 CTCCAATGTTTGAGGACTTAA pLKO.1 1489 3UTR 100% 13.200 9.240 N Zcchc7 n/a
10 TRCN0000215367 CTGTACAGAACAGCATGTAAA pLKO.1 1641 3UTR 100% 13.200 9.240 N Zcchc7 n/a
11 TRCN0000339222 TACAAGCTCATCAGATGATTT pLKO_005 1465 3UTR 100% 13.200 9.240 N Zcchc7 n/a
12 TRCN0000179401 GCCATTATGGACATGAATGTA pLKO.1 680 CDS 100% 5.625 3.938 N Zcchc7 n/a
13 TRCN0000183317 GCCATGATGATTTGTTTCTTA pLKO.1 1190 CDS 100% 5.625 3.375 N Zcchc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.