Transcript: Mouse XM_006537988.3

PREDICTED: Mus musculus coiled-coil domain containing 171 (Ccdc171), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc171 (320226)
Length:
6165
CDS:
471..4469

Additional Resources:

NCBI RefSeq record:
XM_006537988.3
NBCI Gene record:
Ccdc171 (320226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537988.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266976 AGACCGCATTGGGCGAATTTA pLKO_005 1075 CDS 100% 15.000 21.000 N Ccdc171 n/a
2 TRCN0000266974 AGGAAGAGCCAGTGGTATAAT pLKO_005 4495 3UTR 100% 15.000 21.000 N Ccdc171 n/a
3 TRCN0000266973 GACCGTCTCAGATAGGATTAT pLKO_005 4447 CDS 100% 13.200 18.480 N Ccdc171 n/a
4 TRCN0000134573 GTCAGCTCAATAGACATCTTA pLKO.1 3817 CDS 100% 5.625 7.875 N CCDC171 n/a
5 TRCN0000266975 ATAAGCCATCTGGAGTATATC pLKO_005 2361 CDS 100% 13.200 9.240 N Ccdc171 n/a
6 TRCN0000266972 TAGTGGAGACATGCGAGAATA pLKO_005 1714 CDS 100% 13.200 9.240 N Ccdc171 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537988.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.