Transcript: Mouse XM_006537991.2

PREDICTED: Mus musculus coiled-coil domain containing 171 (Ccdc171), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc171 (320226)
Length:
6034
CDS:
472..4338

Additional Resources:

NCBI RefSeq record:
XM_006537991.2
NBCI Gene record:
Ccdc171 (320226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266976 AGACCGCATTGGGCGAATTTA pLKO_005 1076 CDS 100% 15.000 21.000 N Ccdc171 n/a
2 TRCN0000266974 AGGAAGAGCCAGTGGTATAAT pLKO_005 4364 3UTR 100% 15.000 21.000 N Ccdc171 n/a
3 TRCN0000266973 GACCGTCTCAGATAGGATTAT pLKO_005 4316 CDS 100% 13.200 18.480 N Ccdc171 n/a
4 TRCN0000134573 GTCAGCTCAATAGACATCTTA pLKO.1 3818 CDS 100% 5.625 7.875 N CCDC171 n/a
5 TRCN0000266975 ATAAGCCATCTGGAGTATATC pLKO_005 2362 CDS 100% 13.200 9.240 N Ccdc171 n/a
6 TRCN0000266972 TAGTGGAGACATGCGAGAATA pLKO_005 1715 CDS 100% 13.200 9.240 N Ccdc171 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537991.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.